Stem cell research - PDFSEARCH.IO - Document Search Engine

Stem cell research
Results: 1328

#	Item
701	NEWS RELEASE: Westly Appoints Burnham Institute CEO To Stem Cell Oversight Committee Add to Reading List Source URL: www.sco.ca.gov Language: English - Date: 2014-11-28 04:04:49 Steve Westly Sanford-Burnham Medical Research Institute California Institute for Regenerative Medicine John C. Reed Biology Stem cells California Proposition 71
702	Microsoft PowerPoint - 03 Hardiman Bloomington slides.pptx Add to Reading List Source URL: www.flcmidwest.org Language: English - Date: 2014-05-21 13:51:00 Technology Warf Hector DeLuca Stem cell Wisconsin Alumni Research Foundation Patent Vitamin D Biology Harry Steenbock University of Wisconsin–Madison
703	Stem cell research Stem cells offer a new and exciting avenue of medical research that may revolutionise the future treatment of MND as well as a great number of other degenerative conditions. The Association recognises Add to Reading List Source URL: www.mndassociation.org Language: English - Date: 2014-08-20 05:59:06 Cell biology Cloning Developmental biology Stem cell Embryonic stem cell Induced pluripotent stem cell Motor neurone disease Stem cell controversy Cell potency Biology Stem cells Biotechnology
704	TGAAGCAGATGAAGCAGATGAAGCAGATGAAGCAGATGAAGCAGATGAAGCAGATGAAGCAGATGAAGCAGATGAAGCAGATGAAGCAGATGAAGCAGA AGCAGATGAAGCAGATGAAGCAGATGAAGCAGATGAAGCAGATGAAGCAGATGAAGCAGATGAAGCAGATGAAGCAGATGAAGCAGATGAAGCAGATGA AGATGAAGCAGATGAAGCAG Add to Reading List Source URL: myeloma.uams.edu Language: English - Date: 2014-05-19 15:11:44 Immunosuppressants Stem cells Cancer organizations Multiple myeloma Hematopoietic stem cell transplantation University of Arkansas for Medical Sciences Multiple Myeloma Research Foundation Thalidomide Hematological malignancy Medicine Hematologic neoplasms Cancer research
705	Keyword: Part II Measures Implemented to Promote Science and Technology Add to Reading List Source URL: www.mext.go.jp Language: English - Date: 2013-01-15 03:23:36 Developmental biology Emerging technologies Cloning Cancer research Embryonic stem cell Induced pluripotent stem cell Shinya Yamanaka Cancer stem cell Regenerative medicine Biology Stem cells Biotechnology
706	Report of the workshop on the regulation of regenerative medicine Add to Reading List Source URL: www.mhra.gov.uk Language: English - Date: 2013-05-24 11:21:05 Stem cells Clinical research Emerging technologies Cell therapy European Medicines Agency Medicines and Healthcare products Regulatory Agency Regenerative medicine Medical Research Council Stem cell Biology Biotechnology Pharmaceutical industry
707	Research Interest Group CHRONIC COMORBID CONDITIONS Background & Significance Individuals are living long-term with chronic conditions that do not live in isolation, but that exist in comorbid clusters. For example, in Add to Reading List Source URL: www.enrs-go.org Language: English - Date: 2011-03-03 16:10:00 Healthcare Chronic Cardiovascular disease Diabetes mellitus Hematopoietic stem cell transplantation Disease management Medicine Health Comorbidity
708	Exceptional contributions to cancer research recognized at Cancer Research Conference Awards For immediate Release October 28, 2013 (TORONTO) - The Canadian Cancer Research Alliance (CCRA) announced today the recipients Add to Reading List Source URL: www.ccra-acrc.ca Language: English - Date: 2013-10-28 11:15:10 John Dick Victor Ling Cancer stem cell Institute of Cancer Research BC Cancer Research Centre Allen C Eaves Medicine Cancer organizations Cancer research
709	Newsletter Volume 13 Issue 1 May 2007 CONTENTS CIBMTR Working Committees in the Spotlight Add to Reading List Source URL: www.cibmtr.org Language: English - Date: 2010-10-29 17:49:05 Stem cells Center for International Blood and Marrow Transplant Research Hematopoietic stem cell transplantation Acute myeloid leukemia National Marrow Donor Program Graft-versus-host disease Cord blood bank Donor lymphocyte infusion Cord blood Medicine Biology Transplantation medicine
710	Gene Transfer and Insertional Mutagenesis Molecular and Gene Therapy Program Division of Experimental Hematology Children‘s Hospital Research Foundation Cincinnati Add to Reading List Source URL: osp.od.nih.gov Language: English - Date: 2013-12-16 09:43:26 Genetics Gene delivery Developmental biology Gene therapy Stem cell Insertional mutagenesis Retrovirus Biology Biotechnology Molecular biology

UPDATE